Bio-Tools-CodonOptTable

A codon quality check tool, it produces a Codon Optimization table to see the quality of each codon.

The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid.

We produces each codon frequency, Relative Synonymous Codons Uses and Relative Adaptiveness of a Codon that can help to calculate the Codon Adaptation Index (CAI) of a gene.

We generate a Graph between RSCU & RAC for better analysis.

Reference:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3547335

USES or Examples

You can use this module in the following ways

    use Bio::Tools::CodonOptTable;

    my $seqobj = Bio::Tools::CodonOptTable->new(
        -seq              => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
        -id               => 'GeneFragment-12',
        -accession_number => 'Myseq1',
        -alphabet         => 'dna',
        -is_circular      => 1,
        -genetic_code     => 1,
    );
    
    #If you wanna read from file
    my $seqobj = Bio::Tools::CodonOptTable->new(
        -file         => "contig.fasta",
        -format       => 'Fasta',
        -genetic_code => 1,
    );
    
    #If you have Accession number and want to get file from NCBI
    my $seqobj = Bio::Tools::CodonOptTable->new(
        -ncbi_id      => "J00522",
        -genetic_code => 1,
    );
    
    my $myCodons = $seqobj->rscu_rac_table();
    
    if ($myCodons) {
        foreach my $each_aa (@$myCodons) {
            print "Codon      : ", $each_aa->{'codon'},     "\t";
            print "Frequency  : ", $each_aa->{'frequency'}, "\t";
            print "AminoAcid  : ", $each_aa->{'aa_name'},   "\t";
            print "RSCU Value : ", $each_aa->{'rscu'},      "\t";    #Relative Synonymous Codons Uses
            print "RAC Value  : ", $each_aa->{'rac'},       "\t";    #Relative Adaptiveness of a Codon
            print "\n";
        }
    }
    
    # To get the prefered codon list based on RSCU & RAC Values
    my $prefered_codons = $seqobj->prefered_codon($myCodons);
    while ( my ( $amino_acid, $codon ) = each(%$prefered_codons) ) {
        print "AminoAcid : $amino_acid \t Codon : $codon\n";
    }
    
    # To produce a graph between RSCU & RAC
    # Graph output file extension should be GIF, we support GIF only
    $seqobj->generate_graph( $myCodons, $outfile_name );
    
    # To Calculate Codon Adaptation Index (CAI)    
    my $gene_cai = $seqobj->calculate_cai($myCodons);

    # To Produce HTML report
    # This function will generate HTML report, outfile extension should be .html
    $seqobj->generate_report($outfile_name);

INSTALLATION

To install this module, run the following commands:

	perl Makefile.PL
	make
	make test
	make install

SUPPORT AND DOCUMENTATION

After installing, you can find documentation for this module with the
perldoc command.

    perldoc Bio::Tools::CodonOptTable

You can also look for information at:

    RT, CPAN's request tracker
        http://rt.cpan.org/NoAuth/Bugs.html?Dist=Bio-Tools-CodonOptTable

    AnnoCPAN, Annotated CPAN documentation
        http://annocpan.org/dist/Bio-Tools-CodonOptTable

    CPAN Ratings
        http://cpanratings.perl.org/d/Bio-Tools-CodonOptTable

    Search CPAN
        http://search.cpan.org/dist/Bio-Tools-CodonOptTable


COPYRIGHT AND LICENCE

Copyright (C) 2010 Rakesh Kumar Shardiwal

This program is free software; you can redistribute it and/or modify it
under the same terms as Perl itself.